Java Type Script Object Oriented Way of Approach:
Java Type Script Object Oriented Way of Approach
1.The following are accurate methods of defining variables in TypeScript, besides _________.
1.var NumberOfDNA=10231
2.var DNA:string
3.var DNA:string= "CGATAATCGGGGAATTTCAG"
4.var 10231
Answer: 4)var 10231
2.Inheritance is carried out with the aid of using the use of the ________ key-word.
1.implements
2.extends
3.namespace
4.None of the alternatives
Answer: 2)extends
3." var jarvis = feature (x: number, y?: number): number " showcases _________.
1.Defining Parameter
2.Both the alternatives
3.Type annotation
Answer: 2)Both the alternatives
4.Syntax for a decorator is _________.
1.@symbol
2.?symbol
3.*(symbol)
4.#symbol
Answer: 1)@symbol
5.Which of the alternatives is used correctly in JavaScript code?
1.feature reverse(s: string) : string;
2.feature reverse (s: String) : String;
Answer: 1)feature reverse(s: string) : string;
6.fee && typeof fee == "DataType" is used for _________.
1.Overloading
2.Type annotation
3.Overriding
4.Inheritance
Answer: 1)Overloading
7.Which of the 2 is used correctly in JavaScript code:
1.feature reverse(s: string) : string;
2.feature reverse (s: String) : String;
Answer: 1)feature reverse(s: string) : string;
Disclaimer: This site is for pure educational purpose
only. we recommend it only for reference. we still encourage to go through the
course and learn the topics
Key Words: fresco play ,frescoplay.me ,fresco play dumps ,frescoplay courses without handson ,fresco play tcs ,fresco play login ,fresco play app ,frescoplay bootstrap handson ,fresco play handson ,fresco play github ,fresco play answers ,fresco play angular hands on answers ,fresco play azure hands on answers ,fresco play ansible hands-on answers ,fresco play answers github ,fresco play activity tracker ,fresco play aws answers ,fresco play bootstrap hands on solutions ,fresco play blockchain answers ,fresco play courses ,fresco play courses answers ,fresco play cloud computing answers ,fresco play css hands on answers ,fresco play courses to increase t factor ,fresco play courses answers pdf ,fresco play continuous integration answers ,fresco play download ,fresco play dumps tcs ,fresco play devops answers ,fresco play devsecops handson ,fresco play dumps telegram ,fresco play dumps apk ,fresco play docs ,fresco play data mining answers ,fresco play easy courses ,aws essentials fresco play answers ,javascript essentials fresco play hands on ,endpoint security fresco play answers ,javascript essentials fresco play ,play.fresco.em ,fresco play for android ,fresco play for ios ,fresco play for iphone ,answers for frescoplay courses ,fresco play t factor ,cloud foundry fresco play answers ,fresco play t factor dumps ,fresco play without final assessment ,fresco play hands on answers ,fresco play python hands on answers ,fresco play milestone challenge ,fresco play hands on dumps ,fresco play javascript hands-on answers ,fresco play git hands on answers ,fresco play google cloud essentials ,fresco play gems ,fresco play gradle answers ,fresco playground ,go/fresco play ,fresco play html5 audio hands on answers ,fresco play html5 hands on solutions ,fresco play hands on answers python ,fresco play hackerrank solution ,fresco play hands on answers git ,fresco play html5 ,fresco play iot answers ,fresco play in tcs ,fresco play iot game ,fresco play ios app ,fresco play is tcs cod platforms ,fresco play is tcs code platforms ,fresco play in ultimatix ,fresco play image ,is fresco play good ,fresco play java hands on answers ,fresco play json hands on answers ,fresco play jquery hands on ,fresco play jdbc hands on answers ,fresco play java mini project solutions ,fresco play javascript hands-on simple calculator ,fresco play java hands-on solutions ,fresco play kick off ,kubernetes fresco play ,fresco play login tcs ,fresco play linear algebra ,al fresco playa del carmen ,playa montroig al fresco ,fresco play me ,fresco play meaning ,fresco play me tcs ,frescoplay.me app ,fresco play miles award ,fresco play maven handson ,fresco play milestone challenge questions ,me.fresco play ,play.fresco.me tcs ,https play fresco me home ,fresco play npm handson answers ,fresco play node js hands on ,fresco play nosql answers ,fresco play not opening ,nosql gnosis fresco play ,bootstrap navbar fresco play ,node js fresco play ,html5 navigation fresco play ,fresco play office 365 ,fresco play on mobile ,fresco play online ,fresco play hands on ,image classification fresco play hands on ,prodigious git fresco play hands on ,fresco play app for ios ,fresco play app for tcs ,fresco play python oops hands on answers ,fresco play pandas hands on ,fresco play power bi answers ,fresco play powershell answers ,fresco play quiz answers ,fresco play quora ,fresco play questions and answers pdf ,fresco play quiz ,fresco play python qualis ,fresco play devops quiz answers ,fresco play python qualis handson ,fresco play python qualis answers ,fresco play r basics hands on answers ,fresco play r basics hands-on ,fresco play regression analysis hands on ,fresco play registration form ,fresco play r programming hands on answers ,r hands on fresco play ,respuestas cursos fresco play ,r basics handson fresco play ,fresco play r basics answers ,fresco play solutions ,fresco play spring boot hands on ,fresco play selenium hands on answers ,fresco play sap answers ,fresco play sqlite handson ,fresco play support ,database security fresco play ,tcs fresco play solutions ,fresco play tcs answers ,fresco play tcs app ios ,fresco play typescript handson ,fresco play tcs quora ,fresco play typescript answers ,fresco play t factor answers ,fresco play ultimatix ,fresco play ui design ,fresco play update ,data visualization fresco play answers ,fresco play web version ,computer vision fresco play ,fresco play wiki ,fresco play without hands on ,fresco play wikipedia ,www.fresco play ,wireframing fresco play ,fresco play login with ultimatix ,fresco play not working ,fresco play tcs dumps ,fresco play answers pdf ,fresco play 1.99 challenge ,fresco 2 players ,office 365 fresco play ,python 3 fresco play ,fresco play python3 handson ,fresco play 5.9.1,fresco play milestone challenge ,fresco play milestone challenge solution ,fresco play milestone challenge git ,fresco play milestone challenge answers ,fresco play milestone challenge 1.99 ,fresco play milestone challenge dumps ,fresco play t factor milestone challenge ,fresco play milestone challenge questions ,me.fresco play ,tcs fresco play milestone challenge questions ,tcs fresco play milestone challenge answers ,what is fresco play milestone challenge,t factor dumps ,t factor dumps google drive ,t factor milestone challenge ,t factor dumps pdf ,t factor handson dumps ,t factor courses without hands on ,t factor handson answers ,t factor dumps app ,t factor in tcs ,t factor answers ,t factor aix ,t factor appraisal comments ,t factor app ,t factor analysis model ,t factor the protein works ,t factor tcs answer key ,t factor bigger better answers ,t factor bindings ,t factor bigger better questions ,t factor by tabu ,t factor book ,t factor boots ,how to increase t factor without handson ,t factor 1.99 challenge,tcs t factor answers ,t factor tcs answer key ,tcs t factor milestone challenge answers ,tcs t factor questions and answers ,t factor answers ,t factor tcs dumps ,tcs t factor ,tcs t factor handson ,t factor tcs ,t factor in tcs ,what is the use of t factor in tcs ,what is t factor in tcs ,t factor tcs login ,tcs t factor quiz answers ,where to find t factor in ultimatix,tcs digital package ,tcs digital exam ,tcs digital salary ,tcs digital coding questions 2021 ,tcs digital interview questions ,tcs digital results 2021 ,tcs digital learning ,tcs digital previous question papers ,tcs digital aptitude questions ,tcs digital advanced coding questions ,tcs digital apply ,tcs digital archives ,tcs digital aptitude syllabus ,tcs digital application last date ,tcs digital and tcs ninja ,tcs digital advanced coding questions pdf ,tcs digital advanced coding ,tcs digital bond ,tcs digital base salary ,tcs digital bangalore ,tcs digital branches ,tcs digital bank ,tcs digital basic salary ,tcs digital blitz ,tcs digital business ,tcs digital coding ,tcs digital capability assessment ,tcs digital coding questions quora ,tcs digital cadre salary ,tcs digital ctc ,tcs digital coding questions github ,tcs digital coding questions geeksforgeeks ,c programs for tcs digital ,tcs digital drive 2021 ,tcs digital difficulty level ,tcs digital dca ,tcs digital designation ,tcs digital dumps ,tcs digital data interpretation questions ,tcs digital drive 2022 batch ,tcs digital data structure questions ,tcs digital quora ,tcs digital exam date ,tcs digital exam for tcs employees ,tcs digital exam 2021 ,tcs digital exam for tcs employees 2021 ,tcs digital exam previous papers ,tcs digital exam questions ,tcs digital experience ,tcs digital fresher salary ,tcs digital for 2022 batch ,tcs digital for tcs employees ,tcs digital faceprep ,tcs digital from tcs nqt ,tcs digital for tcs employees 2021 ,tcs digital free mock test ,tcs digital for 2021 batch ,tcs digital geeksforgeeks ,tcs digital gfg ,tcs digital glassdoor ,tcs digital growth ,tcs digital github ,tcs digital geometry questions ,tcs digital grade ,tcs digital good ,tcs digital hiring ,tcs digital hiring 2022 ,tcs digital hub ,tcs digital hiring questions ,tcs digital hiring coding questions ,tcs digital hiring 2022 syllabus ,tcs digital how to crack ,tcs digital hike ,tcs digital in hand salary ,tcs digital interview experience 2021 ,tcs digital ion ,tcs digital interview results 2021 ,tcs digital interview experience gfg ,tcs digital in hand salary quora ,tcs digital internship ,is tcs digital good ,is tcs digital tough ,is tcs digital product based company ,is tcs digital and tcs nqt same ,is tcs digital easy to crack ,is tcs digital worth joining ,is tcs digital interview tough ,is tcs digital mass recruiter ,tcs digital job description ,tcs digital job ,tcs digital job location ,tcs digital java questions ,tcs digital joining bonus ,tcs digital joining date ,tcs digital joining letter ,tcs digital java interview questions ,tcs digital key ,tcs digital kolkata ,tcs ion digital knockdown the lockdown ,tcs ion digital kurnool ,tcs digital zone karapakkam address ,tcs digital 2020 answer key ,tcs ion digital zone kovilambakkam ,tcs ion digital zone karmanghat ,tcs digital learning hub ,tcs digital last year question paper ,tcs digital last date ,tcs digital logo ,tcs digital location ,tcs digital linkedin ,tcs digital last date to apply 2022 ,tcs digital mock test ,tcs digital marketing jobs ,tcs digital marketing ,tcs digital mcq questions ,tcs digital monthly salary ,tcs digital marketing salary ,tcs digital means ,tcs digital marking ,tcs digital nqt ,tcs digital ninja ,tcs digital nqt syllabus ,tcs digital nextstep ,tcs digital nqt questions ,tcs digital negative marking ,tcs digital ninja package ,tcs digital nqt mock test ,work in tcs digital ,internal tcs digital ,tcs digital off campus ,tcs digital on campus ,tcs digital offer letter ,tcs digital online test ,tcs digital on campus interview experience ,tcs digital offer letter pdf ,tcs digital office ,tcs digital on campus experience ,tcs digital pattern ,tcs digital preparation ,tcs digital package for freshers 2021 ,tcs digital profile ,tcs digital preparation quora ,tcs digital package quora ,tcs digital questions ,tcs digital quantitative aptitude ,tcs digital question pattern ,tcs digital quant questions ,tcs digital questions prepinsta ,tcs digital qualifications ,tcs digital question paper pdf ,questions asked in tcs digital ,tcs digital role ,tcs digital registration for 2022 batch ,tcs digital recruitment ,tcs digital registration ,tcs digital registration for 2021 batch ,tcs digital resume ,tcs digital reasoning questions ,are tcs digital results out ,are tcs digital questions repeated ,tcs digital syllabus ,tcs digital salary breakup ,tcs digital salary after 2 years ,tcs digital service agreement ,tcs digital selection process ,tcs digital salary quora ,tcs digital sample paper ,tcs digital test ,tcs digital technical interview ,tcs digital through nqt ,tcs digital test 2021 ,tcs digital technologies ,tcs digital technical interview questions ,tcs digital to innovator ,tcs digital training ,tcs digital upgrade ,tcs digital unit ,tcs digital upcoming exam ,tcs ultimatix digital ,tcs digital interactive unit ,tcs ninja to digital upgrade ,tcs digital profile in ultimatix ,tcs digital vs tcs ninja ,tcs digital verbal questions ,tcs digital vs tcs ,tcs digital vit ,tcs digital vs infosys power programmer ,tcs digital vacancy ,tcs digital verbal syllabus ,tcs digital vs deloitte ,tcs digital work ,tcs digital wings 1 ,tcs digital workplace ,tcs digital website ,tcs digital work life balance ,tcs digital wings 1 aptitude questions ,tcs digital welcome kit ,tcs digital work experience quora ,www.tcs ion digital ,tcs digital youtube ,tcs digital previous year questions ,tcs digital previous year coding questions ,tcs digital previous year aptitude questions ,tcs digital previous year advanced coding questions ,tcs digital last year paper ,tcs digital for 1 year experience ,tcs digital zone ,tcs digital zone chennai address ,tcs digital zone chennai ,tcs ion digital zone contact number ,tcs ion digital zone powai ,tcs ion digital zone peenya ,tcs digital rounds ,tcs digital for experienced ,tcs digital compiler ,tcs digital question ,tcs digital 1st round ,tcs digital 1st round question papers ,tcs digital wings 1 coding questions ,tcs digital wings 1 assessment ,tcs digital wings 1 syllabus ,tcs digital profile 100 ,tcs digital 2021 ,tcs digital 2021 syllabus ,tcs digital 2022 syllabus ,tcs digital 2021 exam date ,tcs digital 2021 results ,tcs digital 2022 registration ,tcs digital 2020 question paper ,tcs digital 2021 salary ,tcs class 3 digital signature ,tcs digital placement ,tcs digital 4.0 ,tcs digital 5 forces ,tcs digital salary after 5 years ,tcs digital for experienced professionals ,tcs digital 7th august ,tcs digital 7lpa ,tcs digital 7th august 2021 ,tcs digital 7 august 2021 ,tcs digital 7 lpa breakdown ,tcs digital 8th august ,tcs digital 8th august 2021 ,tcs digital 8th august 2021 answer key ,tcs digital 2020,Course Name,Blockchain - Potentes nexus ,Blockchain Intermedio ,Azure Essentials ,AWS Essentials ,Cloud Computing ,DevOps Culture ,IOT Prime ,Cybersecurity Prologue ,UI Design ,JSON ,Clustering - The Data Ensemble ,Caching Techniques ,NoSQL - Database Revolution ,Continuous Deployment ,Continuous Integration ,Drupal - A Content Vault ,TypeScript - JavaScript's Superset ,APIGEE - API Services ,Automatix - Art of RPA ,Infrastructure as Code ,Digital Primer ,Digital Marketing Primer ,Machine Learning - Exploring the Model ,Machine Learning Axioms ,Data Mining Methods Basics ,Image Classification ,Structured Data Classification ,Statistics and Probability Basics ,Advanced Statistics and Probability ,Linear Algebra ,R Basics ,Intuitive Visualization Basics ,More on Git ,Git Slack Integration ,Maven - Coalescing Pipeline ,Unstructured Data Classification ,Continuous Integration with Jenkins ,Leading and Managing Teams in a Digital World ,Digital for Industries ,Microservices Architecture ,Node.js Essentials ,Service Deployment Concepts ,Service Discovery ,API Gateways ,APIGEE - API Services ,APIGEE - Analytics Services ,APIGEE - Developer Services ,Xamarin Exordium ,Ionic Framework ,Mobile Primer ,Scala Constructs ,Spark Preliminaries ,Scala - The Diatonic Syallable ,Cassandra Brass Tacks ,Angular 2 Routes and Forms ,Node.js Essentials ,HTML5 Semantic Elements ,Styling with CSS3 ,Automatix - Art of RPA ,Elements of User Experience ,UI Design ,Color Theory ,Wireframing ,Design Thinking Methodologies ,User Research Methods ,Usability Principles ,Blockchain - Potentes nexus ,Azure Essentials ,AWS Essentials ,Clustering - The Data Ensemble ,Machine Learning Axioms ,Data Mining Methods Basics ,Machine Learning - Exploring the Model ,Image Classification ,Structured Data Classification ,Statistics and Probability Basics ,Advanced Statistics and Probability ,Linear Algebra ,R Basics ,Intuitive Visualization Basics ,More on Git ,Git Slack Integration ,Maven - Coalescing Pipeline ,Unstructured Data Classification ,DevOps Culture ,Continuous Deployment ,Continuous Integration ,Continuous Integration with Jenkins ,Infrastructure as Code ,Digital Marketing Primer ,Leading and Managing Teams in a Digital World ,Digital for Industries ,Digital Primer ,Microservices Architecture ,Caching Techniques ,Node.js Essentials ,Service Deployment Concepts ,Service Discovery ,API Gateways ,APIGEE - Analytics Services ,APIGEE - Developer Services ,Xamarin Exordium ,Ionic Framework ,Mobile Primer ,Scala Constructs ,Spark Preliminaries ,Scala - The Diatonic Syallable ,NoSQL - Database Revolution ,Cassandra Brass Tacks ,Angular 2 Routes and Forms ,Node.js Essentials ,HTML5 Semantic Elements ,Styling with CSS3 ,JSON ,Elements of User Experience ,Color Theory ,Wireframing ,Design Thinking Methodologies ,User Research Methods ,Usability

Post a Comment